Chromosome XIII – A brief description

The organization and features of chromosome XIII is very consistent with the others observed in S. cerevisiae. Generally, genes appear to be evenly distributed through the genome, having no preference for a DNA strand, and having lower density in the telomeric region. Chromosome XIII has a length of 924430 bp, which correspond to a total of 607 genes. There are 268030 bp in one arm and 656280 bp, in the other. Among the genome of this chromosome, there are 27 genes corresponding to ARS (autonomously replicating sequence), which promote high rate of transformation and extrachromosomal maintenance of plasmid DNA ⁽²⁾. Analysis has shown that they function as origins of DNA duplication ⁽²⁾. One of the nucleotide sequences of an ARS gene is shown below, in image 1. In addition to the ARS genes, there are genes throughout the chromosome in charge of its replication, among them are GIM5/ YML094W, which is responsible for the biogenesis of microtubules; SPG5/YMR191W, required for proteasome assembly, and SPG4/YMR107 both required for high temperature survival, and both genes responsible for the stationary phase. Also, SGS1/YMR190C, in charge of maintaining genome’s integrity and MSS11/YMR164C, a transcription factor, involved in regulation of invasive growth and starch degradation. These are only a few examples of the many genes capable of replicating chromosome XIII.

GTTGTCATTGAGTGAAATCAATTGAAAGTATGTACATTTGGAAGAGCATATGTTAAATATTTTATTTATAGATTTTTCGTTGTGAAATATTATTTTTTTTTTTTTGAAAAAAATGTCGGACTTTATTCCTCCTAATTATTAATAAAATACGAATATATATCTAAATATAATTAATGCTTATTTACATGAAAAATCATCAATCGTAAACAGTTGATTAAAAAACAAAAACTTTATCGGTTCCATTACC

Image 1: Nucleotide sequences of an ARS gene (chrXIII chrXIII:94217..94463 class=ARS length=247 bp )

⁽¹⁾ S. Bowman, C. Churcher, K. Badcock, D. Brown, T. Chillingworth, et al; The nucleotide sequence of Saccharomyces cerevisiae chromosome XIII; The Sanger Centre, Welcome Trust Genome Campus, Hinxton, Cambridge CB10 1SA, UK

⁽²⁾  Clyne RK, Kelly TJ; Identification of autonomously replicating sequence (ARS) elements in eukaryotic cells; Page 1; 1997 Nov 13

Grupo 4.3

Licenciatura bioquimica Uminho

Adriano Silva

Inês Ferreira

Thais Silva

Francisco Magalhães

Saccharomyces cerevisiae’s chromosome VI characterization      

             

The VI chromosome cerevisiae Saccharomyces presents 26.98 Kb, which comparatively with other chromosomes of this yeast, we can see that this one presents smaller dimensions than the others. Concerning the size of the two arms of this chromosome, we have a smaller arm with 121534 pairs of bases and a longer arm with 148510 pairs of bases. Concerning the number of genes, the chromosome presents 129 known/predicted genes, with 300 pairs of bases or longer.

This chromosome presents 14 ARS’s: 600; 600.4; 601; 602; 603; 603.1; 603.5; 604; 605; 606; 607; 608; 609; 610; of which the ARS603 (image 1) is involved in replication. The ARS603 is active during the second half of the S phase, in 67% of the cell cycles.

In summary, this chromosome presents several genes, that are responsible for the replications, of which the YFR001w, YFR002w, YFR006w, YFR008w, YFR009w, and many others. If you want see more searches the link below:

https://browse.yeastgenome.org/?loc=chrVI%3A61185..64064&tracks=DNA%2CAll%20Annotated%20Sequence%20Features%2CXrn1-sensitive_unstable%20transcripts_XUTs%2CScGlycerolMedia%2C3%27UTRs%2CPolII_occupancy_WT&highlight

                                            Image 1. Characteristics and sequence of the ARS603

Grupo 2.2
Licenciatura em Bioquímica
Bárbara Carvalho
Hugo Oliveira
Marta Gomes
João Gomes
Gonçalo Barreira

Saccharomyces cerevisiae : Chromosome XI

               Saccharomyces cerevisiae’s genome contains sixteen chromosomes. Here we focus on the eleventh chromosome using information retrieved from (Saccharomyces genome database).[1]

               The chromosome XI has a total length of 666 816 basepairs (bp). The centromere is located between the bases 440 129 and 440 246. The smallest arm has a length of 226 570 bp while the longest has a total of 440 128 bp. This chromosome consists of 338 genes. There are sixteen ARS’ (autonomously replicating sequences) present. ARS1126, whose coordinates are: 196042…196287 has the nucleotide sequence on the figure below (Figure 1). Similarly to other chromosomes, chromosome XI contains genes involved in replication, some are shown on table 1.

Figure 1. ARS1126 -Nucleotide sequence

Table 1. Genes involved in replication and small description of each.

---

[1] Saccharomyces genome database

Carlos Vedor, João Gonçalves, Mariana Gomes, Sara Barbosa, Sofia Tenreiro

Licenciatura em Bioquímica – Universidade do Minho

Saccharomyces cerevisiae - Chromosome V

The S. cerevisiae genome, the first one to be sequenced, has approximately 12 000 000 bp and 6000 genes, which are organized in 16 chromosomes. Chromosome V has 576 874 bp and 356 genes. The short arm of the chromosome has 151 987 bp, while the long arm has 424 058 bp. Its centromere is located at 151987-152104 bp.

 As represented in Figure 1, 323 of the chromosome’s genes are functional (ORF- open reading frame), which corresponds to 77,6% of the chromosome. Other significant percentages correspond to long terminal repeat (7,9%), transference RNA genes (4,8%) and ARS (autonomously replicating sequence- 5%).

Figure 1: Chromosome V’s feature types-https://www.yeastgenome.org/contig/Chromosome_V#feature

There are a total of 21 ARS, one of which is ARS502, that has the following genomic sequence: 

TAACTGTTACCAAGCGCACATATTTGCATTTGCCTTAGCACAGTGACAAAATAAAACACGTAATCTGAAGTGAGTCCGTCAAGCGTCTT

         Chromosome V has approximately 30 genes related to DNA replication, such as gene MCM3/YEL032W, that translates into a component of the Mcm2-7 hexameric helicase complex that binds chromatin as a part of the pre-replicative complex; gene PMP2/YEL017C-A, for positive regulation of the plasma membrane H⁺-ATPase activity; gene CHZ1/YER030W, which encodes a histone chaperone for Htz1p/H2A-H2B- dimer ; gene RAD3/YER171W for a 5' to 3' DNA helicase, involved in nucleotide excision repair and transcription; gene FCY2/YER056C for a purine-cytosine permease that mediates purine and cytosine accumulation.

Reference: Saccharomyces Genome Database - https://www.yeastgenome.org/

Ana Rita Fernandes, Ângela Sousa, Inês Gomes, Marta Rodrigues, Sara Pereira, Degree in Biochemistry, University of Minho

The features of Chr I of "Saccharomyces cerevisiae"

Chromosome I

Here we will describe Chromosome I (ChrI) of Saccharomyces cerevisiae, the smallest of sixteen chromosomes. It is constituted by a total of 230218 bp where one arm is composed by 78753 bp and the other one is 151465 bp. It is founded by 89 ORFs plus 4 tRNA genes (93 genes total). At least 5 of them are involved in replication: YAR007C (Subunit of heterotrimeric Replication Protein A - RPA); YAL013W (Component of the Rpd3L histone deacetylase complex); YAL021C (Component of the CCR4-NOT transcriptional complex); YAL015C (DNA N-glycosylase and apurinic/apyrimidinic (AP) lyase); YAR002W (contributes directly to nucleocytoplasmic transport and maintenance of the nuclear pore complex (NPC) permeability barrier and is involved in gene tethering at the nuclear periphery). There are eleven ARS in this chromosome: ARS102, ARS103 (its sequence is in Figure 1), ARS104, ARS105, ARS106, ARS107, ARS108, ARS101, ARS110, AES11, ARS112.

Figure 1 - Nucleotide sequence of one ARS (ARS103).

Reference:

H. Bussey, et al., 1995, PNAS USA 92:3809-13

Grupo 1.1.

Licenciatura em Bioquímica

Universidade do Minho

Mechanism of DNA Replication (Advanced)

Pretty accurate animation!

Mechanism of Action of Topoisomerase UCSD Chem 114c

Note the activities of topo IB and II.

Enjoy!