Saccharomyces cerevisiae - Chromosome V

The S. cerevisiae genome, the first one to be sequenced, has approximately 12 000 000 bp and 6000 genes, which are organized in 16 chromosomes. Chromosome V has 576 874 bp and 356 genes. The short arm of the chromosome has 151 987 bp, while the long arm has 424 058 bp. Its centromere is located at 151987-152104 bp.

 As represented in Figure 1, 323 of the chromosome’s genes are functional (ORF- open reading frame), which corresponds to 77,6% of the chromosome. Other significant percentages correspond to long terminal repeat (7,9%), transference RNA genes (4,8%) and ARS (autonomously replicating sequence- 5%).

Figure 1: Chromosome V’s feature types-https://www.yeastgenome.org/contig/Chromosome_V#feature

There are a total of 21 ARS, one of which is ARS502, that has the following genomic sequence: 

TAACTGTTACCAAGCGCACATATTTGCATTTGCCTTAGCACAGTGACAAAATAAAACACGTAATCTGAAGTGAGTCCGTCAAGCGTCTT

         Chromosome V has approximately 30 genes related to DNA replication, such as gene MCM3/YEL032W, that translates into a component of the Mcm2-7 hexameric helicase complex that binds chromatin as a part of the pre-replicative complex; gene PMP2/YEL017C-A, for positive regulation of the plasma membrane H⁺-ATPase activity; gene CHZ1/YER030W, which encodes a histone chaperone for Htz1p/H2A-H2B- dimer ; gene RAD3/YER171W for a 5' to 3' DNA helicase, involved in nucleotide excision repair and transcription; gene FCY2/YER056C for a purine-cytosine permease that mediates purine and cytosine accumulation.

Reference: Saccharomyces Genome Database - https://www.yeastgenome.org/

Ana Rita Fernandes, Ângela Sousa, Inês Gomes, Marta Rodrigues, Sara Pereira, Degree in Biochemistry, University of Minho